View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1439_high_8 (Length: 375)
Name: NF1439_high_8
Description: NF1439
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1439_high_8 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 281; Significance: 1e-157; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 281; E-Value: 1e-157
Query Start/End: Original strand, 9 - 346
Target Start/End: Complemental strand, 4217137 - 4216800
Alignment:
| Q |
9 |
gtagattatacttaggattggtagctagatcatggtaaaggctannnnnnnacaataggattcctacaaaagaaaatgtattgcggaaaagagtattcca |
108 |
Q |
| |
|
|||| ||| ||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
4217137 |
gtagtttacacttaggattggtagctagatcatggtaaaggctatttttttacaataggattcctacaaaagaaaatgtattacggaaaagagtattcca |
4217038 |
T |
 |
| Q |
109 |
ttaactgatattcaatgttccagtggttgcgggatggatgaaacagtcgaacatctatttttgagttgtcttgtgtttagaagtctttggtatctgtttc |
208 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4217037 |
ttaactgatattcaatgttcgagtggttgcgggatggatgaaacagtcgaacatctatttttgagttgtcttgtgtttagaagtctttggtatctgtttc |
4216938 |
T |
 |
| Q |
209 |
gacagtggctaggttcacgtccgattagtccatcacatcttgttgatcatgttctccaattcggcaatttaggaggatattcgaatatatatcggtctat |
308 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |||||||||||| |
|
|
| T |
4216937 |
gacagtggctaggttcacagccgattagtccatcacatcttgttgatcatgttctccaattcggcaatttaggaggatattcgaagacatatcggtctat |
4216838 |
T |
 |
| Q |
309 |
tctttgtctaatctagttggcttctgtgtgtattattt |
346 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
4216837 |
tctttgtctgatctagttggcttctgtgtgtattattt |
4216800 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University