View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1439_high_9 (Length: 327)
Name: NF1439_high_9
Description: NF1439
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1439_high_9 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 102; Significance: 1e-50; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 102; E-Value: 1e-50
Query Start/End: Original strand, 1 - 110
Target Start/End: Original strand, 5719856 - 5719965
Alignment:
| Q |
1 |
ttgttacattgatggagcaagcaagcacctttcaatttgcggctacaagctgtgattagctgctcttgcacgtatagttgtttaatttatttaatgtgtt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
5719856 |
ttgttacattgatggagcaagcaagcacctttcaatttgcggctacaacctgtgattagctgctcttgcacgtatagttgtttaatttttttaatgtgtt |
5719955 |
T |
 |
| Q |
101 |
ttttactatc |
110 |
Q |
| |
|
|||||||||| |
|
|
| T |
5719956 |
ttttactatc |
5719965 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 66; E-Value: 4e-29
Query Start/End: Original strand, 177 - 253
Target Start/End: Original strand, 5720032 - 5720111
Alignment:
| Q |
177 |
aaatggaaggttttgaagttaaaacttcaacggttatcatgtgtgac---tatgcgtggaatattacagtttctacttgg |
253 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
5720032 |
aaatggaaggttttgaagttaaaacttcaacggttatcatgtgtgacttgtatgcgtggaatattacagtttctacttgg |
5720111 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University