View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1439_low_14 (Length: 308)
Name: NF1439_low_14
Description: NF1439
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1439_low_14 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 238; Significance: 1e-132; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 238; E-Value: 1e-132
Query Start/End: Original strand, 16 - 298
Target Start/End: Original strand, 41306842 - 41307123
Alignment:
| Q |
16 |
gaaaaaacagtcgatgaatgaatctcttgtactgaccaatagagtttgtnnnnnnngttgataagagtctcgttacaattcttttatatgaaagttttag |
115 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| ||||||| |||||||||||||||||||||||||||| |
|
|
| T |
41306842 |
gaaaaaacagtcgatgaatgaatctcttgtactgaccaatagagtttgtaaaaaaagttgata-gagtctctttacaattcttttatatgaaagttttag |
41306940 |
T |
|
| Q |
116 |
caagcaatgtttgattttgagttcaaacttagaatcttctaattactacttcggcagaatctcttaactcaccatctgagttgtctgtttgggagagaac |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41306941 |
caagcaatgtttgattttgagttcaaacttagaatcttctaattactacttcggcagaatctcttaactcaccatctgagttgtctgtttgggagagaac |
41307040 |
T |
|
| Q |
216 |
gtgacgataattgattcttgccctaaataaatttgcttgcagttgtttaccatgtcaaagattgagatcgttgcaccattcat |
298 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| ||||||| |
|
|
| T |
41307041 |
gtgacaataattgattcttgccctaaataaatttgcttgcagttgtttcccatgtcaaagattgagatcgttgcaacattcat |
41307123 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University