View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1439_low_20 (Length: 249)
Name: NF1439_low_20
Description: NF1439
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1439_low_20 |
 |  |
|
| [»] chr8 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 226; Significance: 1e-125; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 226; E-Value: 1e-125
Query Start/End: Original strand, 4 - 249
Target Start/End: Original strand, 5784797 - 5785042
Alignment:
| Q |
4 |
aagtattgtcaagaatcccacatattaagtgttagagaagtgtcgcatcttcatatatgcgaccagccaacatatcaaaatgtccatacaattatcattt |
103 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| ||||||||| ||||||||||| |
|
|
| T |
5784797 |
aagtattgtcaagaatcccacatattaagtgttagagaagtgtcgcatcttcatatatgcgaccaaccaacatatcaagatgtccatataattatcattt |
5784896 |
T |
 |
| Q |
104 |
gagttatacttacgagacataaatttagtttcttatgaacaataatcaagttcttaagatggttcgcaaagagcgtttttctattttacaaacacataca |
203 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5784897 |
gagttatacttacgagacataaatttaatttcttatgaacaataatcaagttcttaagatggttcgcaaagagcgtttttctattttacaaacacataca |
5784996 |
T |
 |
| Q |
204 |
attcctccattcttaaacataaattaaaatgttcattatttagtat |
249 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
5784997 |
attcctccatccttaaacataaattaaaatgttcattatttagtat |
5785042 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University