View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1439_low_3 (Length: 452)
Name: NF1439_low_3
Description: NF1439
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1439_low_3 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 130; Significance: 3e-67; HSPs: 3)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 130; E-Value: 3e-67
Query Start/End: Original strand, 294 - 427
Target Start/End: Complemental strand, 47262794 - 47262661
Alignment:
| Q |
294 |
ataacaaacttaactttctattactctttattctccaaaattttcaaccatgtccatcctcttcttcctccttctcttcatctctttccacaccccctct |
393 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47262794 |
ataacaaacttaacttactattactctttattctccaaaattttcaaccatgtccatcctcttcttcctccttctcttcatctctttccacaccccctct |
47262695 |
T |
|
| Q |
394 |
ttttctcaaacaccccccaaaggcttcctcatca |
427 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
47262694 |
ttttctcaaacaccccccaaaggcttcctcatca |
47262661 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 73; E-Value: 3e-33
Query Start/End: Original strand, 11 - 87
Target Start/End: Complemental strand, 47263072 - 47262996
Alignment:
| Q |
11 |
aaatcaaacaagcaaaggtcaaagtgaactagtctttgcccatcccactaaaataaatgccgtccttcatcaccctt |
87 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47263072 |
aaatcaaacaagcaaaagtcaaagtgaactagtctttgcccatcccactaaaataaatgccgtccttcatcaccctt |
47262996 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 64; E-Value: 8e-28
Query Start/End: Original strand, 160 - 223
Target Start/End: Complemental strand, 47262928 - 47262865
Alignment:
| Q |
160 |
tctgttctgtcctttgaacctgtctttgttctgaccagttagtttcccgcgtcatcattaatta |
223 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47262928 |
tctgttctgtcctttgaacctgtctttgttctgaccagttagtttcccgcgtcatcattaatta |
47262865 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University