View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1439_low_32 (Length: 218)

Name: NF1439_low_32
Description: NF1439
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1439_low_32
NF1439_low_32
[»] chr1 (2 HSPs)
chr1 (80-141)||(41180131-41180192)
chr1 (140-197)||(41180324-41180381)


Alignment Details
Target: chr1 (Bit Score: 58; Significance: 1e-24; HSPs: 2)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 58; E-Value: 1e-24
Query Start/End: Original strand, 80 - 141
Target Start/End: Original strand, 41180131 - 41180192
Alignment:
80 gccggtagttgtatattagctagattttgtttgtttgttttcgaccacaacacaaacatata 141  Q
    ||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||    
41180131 gccggtagttgtatattagctagattttgtttgtttgttttggaccacaacacaaacatata 41180192  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 140 - 197
Target Start/End: Original strand, 41180324 - 41180381
Alignment:
140 tataatgtacataaatgcagtaaatatgtctcttctgctctttgttcactataatgcc 197  Q
    |||||||||||||||| |||||||||||| |||||| ||||||||  |||||||||||    
41180324 tataatgtacataaatacagtaaatatgtttcttctactctttgtcaactataatgcc 41180381  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University