View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14400_high_1 (Length: 227)
Name: NF14400_high_1
Description: NF14400
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14400_high_1 |
 | |
|
| [»] chr2 (1 HSPs) |
| |
|
Alignment Details
Target: chr2 (Bit Score: 185; Significance: 1e-100; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 185; E-Value: 1e-100
Query Start/End: Original strand, 6 - 227
Target Start/End: Complemental strand, 41637341 - 41637120
Alignment:
| Q |
6 |
agaactaagataacgtaaggattttttatttgaatatcgataatccaaacacagaagaagtgaagacttcctcgttccaaaacagtgaggaaagaagaat |
105 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41637341 |
agaactaagataacgtaaggattttttatttgaatatcgataatccaaacacagaagaagtgaagacttcctcgttccaaaacagtgaggaaagaagaat |
41637242 |
T |
|
| Q |
106 |
ggaactagttgagggttgtaacataggaaagaaattgttggtttccgtttgaacttattcgannnnnnngaaaggttatttggttttgcgtcaatattaa |
205 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||| ||||||| || || ||||||||||||||||||||||||||||||| |
|
|
| T |
41637241 |
ggaactagttgagggttgtaacataggaaagaaagtgttggtttccgtatgaacttgtttgatttttttgaaaggttatttggttttgcgtcaatattaa |
41637142 |
T |
|
| Q |
206 |
gagatatttggttaaagagaaa |
227 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
41637141 |
gagatatttggttaaagagaaa |
41637120 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University