View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14403_high_14 (Length: 290)
Name: NF14403_high_14
Description: NF14403
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14403_high_14 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 67; Significance: 8e-30; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 67; E-Value: 8e-30
Query Start/End: Original strand, 147 - 282
Target Start/End: Complemental strand, 12602559 - 12602424
Alignment:
| Q |
147 |
tcattattaacatcactattcatcactcgttaagagaaggtaaccactacgcagannnnnnngccaaatttggagcttctaatgatgttgttttgactat |
246 |
Q |
| |
|
||||||||||||||||| |||||||||| ||||||||||||||||| | ||| || |||||| ||| ||||||||||||||||||||||||||| |
|
|
| T |
12602559 |
tcattattaacatcactcttcatcactcattaagagaaggtaaccagtgcgcggatttctttgccaaacttgaagcttctaatgatgttgttttgactat |
12602460 |
T |
 |
| Q |
247 |
tcactccgatccttcagaaggccttctccctttgct |
282 |
Q |
| |
|
||||||| | ||| |||| |||||||||||||||| |
|
|
| T |
12602459 |
tcactccaaacctccagagagccttctccctttgct |
12602424 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 1 - 59
Target Start/End: Complemental strand, 12602704 - 12602646
Alignment:
| Q |
1 |
attaagaattaacacagtaaaatgaaatcattgtgcaatttgattaaatacatgtgtca |
59 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
12602704 |
attaagaattaacacagtaaaatgaaatcgttgtgcaatttgattaaatacatgtgtca |
12602646 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University