View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14403_high_18 (Length: 250)
Name: NF14403_high_18
Description: NF14403
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14403_high_18 |
 | |
|
| [»] chr5 (1 HSPs) |
| |
|
Alignment Details
Target: chr5 (Bit Score: 49; Significance: 4e-19; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 198 - 250
Target Start/End: Complemental strand, 12602793 - 12602741
Alignment:
| Q |
198 |
ggcgttattttgcctttaaatcatatagtgtaaaactttgtgcggatacattt |
250 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
12602793 |
ggcgttattttgcctttaaatcatatagtgtaaaactttatgcggatacattt |
12602741 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University