View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14403_high_23 (Length: 226)
Name: NF14403_high_23
Description: NF14403
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14403_high_23 |
 |  |
|
| [»] scaffold1524 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: chr1 (Bit Score: 196; Significance: 1e-107; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 196; E-Value: 1e-107
Query Start/End: Original strand, 9 - 211
Target Start/End: Complemental strand, 28327375 - 28327172
Alignment:
| Q |
9 |
agaagcat-agggaaaatatcagtaacatgagggagtctaaaccgtgcctcaaaatcttcttttaacttagttttccaatcagatctgaaaagtgaagca |
107 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28327375 |
agaagcatcagggaaaatatcagtaacatgagggagtctaaaccgtgcctcaaaatcttcttttaacttagttttccaatcagatctgaaaagtgaagca |
28327276 |
T |
 |
| Q |
108 |
tcaatcttctttaaaaggtagaacgcatgttaaatagaaattgagaaaattatgaacatctcgtctcaattttaagtaggtagtaatttaaaagactaat |
207 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28327275 |
tcaatcttctttaaaaggtagaacgcatgttaaatagaaattgagaaaattatgaacatctcgtctcaattttaagtaggtagtaatttaaaagactaat |
28327176 |
T |
 |
| Q |
208 |
attt |
211 |
Q |
| |
|
|||| |
|
|
| T |
28327175 |
attt |
28327172 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 59; Significance: 4e-25; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 59; E-Value: 4e-25
Query Start/End: Original strand, 9 - 90
Target Start/End: Original strand, 13997784 - 13997866
Alignment:
| Q |
9 |
agaagcat-agggaaaatatcagtaacatgagggagtctaaaccgtgcctcaaaatcttcttttaacttagttttccaatcag |
90 |
Q |
| |
|
|||||||| ||||||||||||||||| |||||||||||||||||||||||||||||||||||| |||||| ||||||||||| |
|
|
| T |
13997784 |
agaagcatcagggaaaatatcagtaatatgagggagtctaaaccgtgcctcaaaatcttctttaaacttatctttccaatcag |
13997866 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold1524 (Bit Score: 30; Significance: 0.00000008; HSPs: 1)
Name: scaffold1524
Description:
Target: scaffold1524; HSP #1
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 9 - 45
Target Start/End: Complemental strand, 328 - 291
Alignment:
| Q |
9 |
agaagcat-agggaaaatatcagtaacatgagggagtc |
45 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
328 |
agaagcatcagggaaaatatcagtaacatgagggagtc |
291 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University