View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF14403_low_22 (Length: 236)

Name: NF14403_low_22
Description: NF14403
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF14403_low_22
NF14403_low_22
[»] chr3 (2 HSPs)
chr3 (159-220)||(13887174-13887235)
chr3 (17-72)||(13887395-13887448)


Alignment Details
Target: chr3 (Bit Score: 58; Significance: 2e-24; HSPs: 2)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 159 - 220
Target Start/End: Complemental strand, 13887235 - 13887174
Alignment:
159 taaaaactgcattgaaagaaggagtttgaagacacattgaacacttgcatatgccagatatt 220  Q
    ||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||    
13887235 taaaaactgcattgaaagaaggagtttgaagacacgttgaacacttgcatatgccagatatt 13887174  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 17 - 72
Target Start/End: Complemental strand, 13887448 - 13887395
Alignment:
17 aactatatcatgaaaagcaaggaaaacatctaatgaatgtaattctatccactgag 72  Q
    |||||||||||||||||| | |||  ||||||||||||||||||||||||||||||    
13887448 aactatatcatgaaaagccaagaa--catctaatgaatgtaattctatccactgag 13887395  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University