View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14403_low_27 (Length: 202)
Name: NF14403_low_27
Description: NF14403
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14403_low_27 |
 |  |
|
| [»] chr2 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 186; Significance: 1e-101; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 186; E-Value: 1e-101
Query Start/End: Original strand, 1 - 202
Target Start/End: Complemental strand, 5727323 - 5727122
Alignment:
| Q |
1 |
tcaaaacaaaaccttaggctttgtccacatattggatttaatatgtttaggttcatggtgcttatgtacgaattgtgatggcctaaaatacactatataa |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| ||||||| |
|
|
| T |
5727323 |
tcaaaacaaaaccttaggctttgtccacatattggatttaatatgtttaggttcatggtgcttatgtacgaattgtgatgacctaaaatacattatataa |
5727224 |
T |
 |
| Q |
101 |
cttatgcaaatgtacgatggatcatcgtatttatgacatacaattaccggtggttgtgacacttgacaaaatgaggtatagcaaaggacaaatgactaaa |
200 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
5727223 |
cttatgcaaatgtacggtggatcatcgtatttatgacatacaattaccggtggttgtgacacttgacataatgaggtatagcaaaggacaaatgactaaa |
5727124 |
T |
 |
| Q |
201 |
ca |
202 |
Q |
| |
|
|| |
|
|
| T |
5727123 |
ca |
5727122 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University