View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF14403_low_27 (Length: 202)

Name: NF14403_low_27
Description: NF14403
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF14403_low_27
NF14403_low_27
[»] chr2 (1 HSPs)
chr2 (1-202)||(5727122-5727323)


Alignment Details
Target: chr2 (Bit Score: 186; Significance: 1e-101; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 186; E-Value: 1e-101
Query Start/End: Original strand, 1 - 202
Target Start/End: Complemental strand, 5727323 - 5727122
Alignment:
1 tcaaaacaaaaccttaggctttgtccacatattggatttaatatgtttaggttcatggtgcttatgtacgaattgtgatggcctaaaatacactatataa 100  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |||||||    
5727323 tcaaaacaaaaccttaggctttgtccacatattggatttaatatgtttaggttcatggtgcttatgtacgaattgtgatgacctaaaatacattatataa 5727224  T
101 cttatgcaaatgtacgatggatcatcgtatttatgacatacaattaccggtggttgtgacacttgacaaaatgaggtatagcaaaggacaaatgactaaa 200  Q
    |||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||    
5727223 cttatgcaaatgtacggtggatcatcgtatttatgacatacaattaccggtggttgtgacacttgacataatgaggtatagcaaaggacaaatgactaaa 5727124  T
201 ca 202  Q
    ||    
5727123 ca 5727122  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University