View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14404_high_13 (Length: 466)
Name: NF14404_high_13
Description: NF14404
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14404_high_13 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 179; Significance: 2e-96; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 179; E-Value: 2e-96
Query Start/End: Original strand, 20 - 218
Target Start/End: Complemental strand, 8931933 - 8931735
Alignment:
| Q |
20 |
gttccgactccacatgcggcggctattatgcaccggaggagaatttccaattcgattaaatccgattcggatatttccgatgttttgagtgaatttggtg |
119 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
8931933 |
gttccgactccacatgcggcggctattatgcaccggaggagaatttccaattcgattaaatccgaatcggatatttccgatgttttgagtgaatttggtg |
8931834 |
T |
|
| Q |
120 |
agaaaattgagaggagtgtgagtgttggtgatgttgatttcagaggtgctgaattgggggagagatttgggggttttgtggagagcagtgagagtgttg |
218 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||||||||||||||||||| ||||||||||| ||||||||||||||| ||||||||||||| |
|
|
| T |
8931833 |
agaaaattgagaggagtgggagtgttggtgatgttgatttcagaggtgctgaattggaggagagatttgagggttttgtggagaggagtgagagtgttg |
8931735 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 140; E-Value: 4e-73
Query Start/End: Original strand, 301 - 452
Target Start/End: Complemental strand, 8931652 - 8931501
Alignment:
| Q |
301 |
ttttgtttctaatttgttgaattctgttgaaaatagtcatgatcatgatcataagggtttggattctacaaagtctacaccttttgatgttggtggtgct |
400 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8931652 |
ttttgtttctaatttgttgaattctgttgaaaatagtcatgatcatgatgataacggtttggattctacaaagtctacaccttttgatgttggtggtgct |
8931553 |
T |
|
| Q |
401 |
gaaaatggtcatgatcatgatagtaagggtttgaattctgcatcttttgatg |
452 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
8931552 |
gaaaatggtcatgatcatgatagtaagggtttgatttctgcatcttttgatg |
8931501 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University