View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14404_high_39 (Length: 291)
Name: NF14404_high_39
Description: NF14404
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14404_high_39 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 72; Significance: 9e-33; HSPs: 3)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 72; E-Value: 9e-33
Query Start/End: Original strand, 97 - 228
Target Start/End: Complemental strand, 26453464 - 26453326
Alignment:
| Q |
97 |
aatgaaaaaagagataagtctaactaatgatccatattcgtgtgttaatagtcggtaat-------nnnnnnnnnnngctttgtttagtgtgtttgaatt |
189 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |||||||||||| |
|
|
| T |
26453464 |
aatgaaaaaagagataagtctaactaatgatccatattcgtgtgttaatagtcggtaataaaaaaaaaaaaaaaaaagctttgtttaatgtgtttgaatt |
26453365 |
T |
|
| Q |
190 |
gtgattcaaaagctttattagagaaatgatgatatatga |
228 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
26453364 |
gtgattcaaaagctttattagagaaatgatgataaatga |
26453326 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 16 - 52
Target Start/End: Complemental strand, 26453546 - 26453510
Alignment:
| Q |
16 |
aatacttaagaaattataagattaaaagtttgtaaga |
52 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26453546 |
aatacttaagaaattataagattaaaagtttgtaaga |
26453510 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 225 - 261
Target Start/End: Complemental strand, 26453292 - 26453256
Alignment:
| Q |
225 |
atgattgattacattccatagaaggtcaattaatcta |
261 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
26453292 |
atgattgattacattccttagaaggtcaattaatcta |
26453256 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 30; Significance: 0.0000001; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 19 - 52
Target Start/End: Complemental strand, 26858651 - 26858618
Alignment:
| Q |
19 |
acttaagaaattataagattaaaagtttgtaaga |
52 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||| |
|
|
| T |
26858651 |
acttaagaaattctaagattaaaagtttgtaaga |
26858618 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University