View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14404_high_40 (Length: 291)
Name: NF14404_high_40
Description: NF14404
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14404_high_40 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 245; Significance: 1e-136; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 245; E-Value: 1e-136
Query Start/End: Original strand, 18 - 281
Target Start/End: Original strand, 29691196 - 29691460
Alignment:
| Q |
18 |
ccactaagagaccttgatgctaaatttactatacatgatgctgattttcagataccatggctgcggtgaccctatagcagttattatagtttttacggat |
117 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
29691196 |
ccactaagagaccttgatgctaaagttactatacatgatgctgattttcagataccatggctgcggtgaccctatagcagttattttagtttttacggat |
29691295 |
T |
 |
| Q |
118 |
tctgtctcaaattatacatacgttgtattataatatcaatataaaataattttgttcttcctaaataatctttgtctattgttatctttttactac-ttt |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
29691296 |
tctgtctcaaattatacatacgttgtattataatatcaatataaaataattttgttcttcctaaataatctttgtctattgttatctttttactactttt |
29691395 |
T |
 |
| Q |
217 |
tttaactcaagcatattttcattcttatctcgataacatcccaccatattttgaggtattctctg |
281 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
29691396 |
tttaactcaagcatattttcattcttatctcgataacatcgcaccatattttgaggtattctctg |
29691460 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University