View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14404_high_41 (Length: 291)
Name: NF14404_high_41
Description: NF14404
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14404_high_41 |
 | |
|
| [»] chr2 (1 HSPs) |
| |
|
Alignment Details
Target: chr2 (Bit Score: 194; Significance: 1e-105; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 194; E-Value: 1e-105
Query Start/End: Original strand, 10 - 291
Target Start/End: Original strand, 45242960 - 45243246
Alignment:
| Q |
10 |
agaagcaaaggtgaggcgcgtggttttcacatcatcaattggtgcagtctatatggaccccaataggagtgttgatgtagaggttgatgagtcttgctgg |
109 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45242960 |
agaagcaaaagtgaggcgcgtggttttcacatcatcaattggtgcagtctatatggaccccaataggagtgttgatgtagaggttgatgagtcttgctgg |
45243059 |
T |
|
| Q |
110 |
agtgatttggagttttgcaagaaaaccaaggtcaataataataatattcacttccctt-cat---------ttcatttatgtagtggttgattgatttga |
199 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||||||| || || || ||||| | ||| |||||||||||||| |
|
|
| T |
45243060 |
agtgatttggagttttgcaagaaaaccaaggtc---aataataatattcacttcatttatatatgtagaggttgattta-ggagt-gttgattgatttga |
45243154 |
T |
|
| Q |
200 |
aattttgttgatattgtagaattggtattgctatgggaaagcagtggcagaagaagcagcatgggatgtagcaaaagagaaaggtgtggatt |
291 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45243155 |
aattttgttgatattgtagaattggtattgctatgggaaagcagtggcagaagcagcagcatgggatgtagcaaaagagaaaggtgtggatt |
45243246 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 29; Significance: 0.0000004; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 217 - 277
Target Start/End: Original strand, 863991 - 864051
Alignment:
| Q |
217 |
agaattggtattgctatgggaaagcagtggcagaagaagcagcatgggatgtagcaaaaga |
277 |
Q |
| |
|
|||| |||||||| |||||||| ||||||| ||| || ||||||||||| |||||||||| |
|
|
| T |
863991 |
agaactggtattgttatgggaagacagtggctgaacaatcagcatgggatatagcaaaaga |
864051 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University