View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF14404_high_45 (Length: 276)

Name: NF14404_high_45
Description: NF14404
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF14404_high_45
NF14404_high_45
[»] chr6 (1 HSPs)
chr6 (162-276)||(3935236-3935350)


Alignment Details
Target: chr6 (Bit Score: 90; Significance: 1e-43; HSPs: 1)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 90; E-Value: 1e-43
Query Start/End: Original strand, 162 - 276
Target Start/End: Complemental strand, 3935350 - 3935236
Alignment:
162 accttctacatgaattcaacgtgatcacaaatannnnnnnggatagaaaaataaaagagagacaaattatagtaccagcgtgaacggtttttgatccatc 261  Q
    |||||| ||||||||||||||||||||||||||       ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
3935350 accttccacatgaattcaacgtgatcacaaatatttttttggatagaaaaataaaagagagacaaattatagtaccagcgtgaacggtttttgatccatc 3935251  T
262 acatttcaaaaacga 276  Q
    |||||||||||||||    
3935250 acatttcaaaaacga 3935236  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University