View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14404_high_54 (Length: 256)
Name: NF14404_high_54
Description: NF14404
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14404_high_54 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 134; Significance: 8e-70; HSPs: 4)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 134; E-Value: 8e-70
Query Start/End: Original strand, 39 - 239
Target Start/End: Original strand, 6339310 - 6339504
Alignment:
| Q |
39 |
aattattggatattatatattgttatctaccgtttattcggtttgtttgaatcaattctaagaaattgatcagttatttggacgcttaaatactttggaa |
138 |
Q |
| |
|
||||| |||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |||| ||||||||||||| ||||||||||||||||| |
|
|
| T |
6339310 |
aattaatggatattatatattgttatctacggtttattcggtttgtttgaatcaattctaagatattggtcagttatttggaagcttaaatactttggaa |
6339409 |
T |
|
| Q |
139 |
cttagtttggaggatatgccgggttgtttatctacgactacgacggtttgacttcatgacaaaggtgtgatgtgtccaacacattgcgttagttgtgttt |
238 |
Q |
| |
|
||||||||||||||| ||||||||||||||| |||||| | || ||| ||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
6339410 |
cttagtttggaggatgtgccgggttgtttat------ctacgaggattcgacatcatgacaaaggtgtgatgtgtctaacacattgcgttagttgtgttt |
6339503 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 112; E-Value: 1e-56
Query Start/End: Original strand, 39 - 240
Target Start/End: Original strand, 6330602 - 6330798
Alignment:
| Q |
39 |
aattattggatattatatattgttatctaccgtttattcgg-tttgtttgaatcaattctaagaaattgatcagttatttggacgcttaaatactttgga |
137 |
Q |
| |
|
||||| ||||||||||||| | |||||||| |||||||||| |||||||||| |||||||||||||||| |||| |||||||| |||||||||||||||| |
|
|
| T |
6330602 |
aattaatggatattatatacttttatctacggtttattcgggtttgtttgaaacaattctaagaaattggtcagctatttggaagcttaaatactttgga |
6330701 |
T |
|
| Q |
138 |
acttagtttggaggatatgccgggttgtttatctacgactacgacggtttgacttcatgacaaaggtgtgatgtgtccaacacattgcgttagttgtgtt |
237 |
Q |
| |
|
|||||||||||||||| || |||||||||| | ||| || | || |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6330702 |
acttagtttggaggatgtgtcgggttgttt------gtctaggaggattcgacttcatgacaaaggtgtgatgtgtccaacacattgcgttagttgtgtt |
6330795 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 5 - 38
Target Start/End: Original strand, 5250245 - 5250278
Alignment:
| Q |
5 |
atttccctcgctgatttttctctttctagtagtg |
38 |
Q |
| |
|
||||||||||||||||||||| |||||||||||| |
|
|
| T |
5250245 |
atttccctcgctgatttttctttttctagtagtg |
5250278 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #4
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 6 - 39
Target Start/End: Original strand, 13145096 - 13145129
Alignment:
| Q |
6 |
tttccctcgctgatttttctctttctagtagtga |
39 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||| |
|
|
| T |
13145096 |
tttccctcgctgatttttctttttctagtagtga |
13145129 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 32; Significance: 0.000000006; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 5 - 40
Target Start/End: Complemental strand, 7623564 - 7623529
Alignment:
| Q |
5 |
atttccctcgctgatttttctctttctagtagtgaa |
40 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||| |
|
|
| T |
7623564 |
atttccctcgctgatttttctttttctagtagtgaa |
7623529 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 31; Significance: 0.00000002; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 5 - 39
Target Start/End: Complemental strand, 2093395 - 2093361
Alignment:
| Q |
5 |
atttccctcgctgatttttctctttctagtagtga |
39 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||| |
|
|
| T |
2093395 |
atttccctcgctgatttttctttttctagtagtga |
2093361 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 5 - 38
Target Start/End: Original strand, 24605944 - 24605977
Alignment:
| Q |
5 |
atttccctcgctgatttttctctttctagtagtg |
38 |
Q |
| |
|
||||||||||||||||||||| |||||||||||| |
|
|
| T |
24605944 |
atttccctcgctgatttttctttttctagtagtg |
24605977 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 5 - 37
Target Start/End: Complemental strand, 17772001 - 17771969
Alignment:
| Q |
5 |
atttccctcgctgatttttctctttctagtagt |
37 |
Q |
| |
|
||||||||||||||||||||| ||||||||||| |
|
|
| T |
17772001 |
atttccctcgctgatttttctttttctagtagt |
17771969 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University