View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14404_high_55 (Length: 255)
Name: NF14404_high_55
Description: NF14404
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14404_high_55 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 204; Significance: 1e-111; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 204; E-Value: 1e-111
Query Start/End: Original strand, 16 - 239
Target Start/End: Complemental strand, 48520867 - 48520645
Alignment:
| Q |
16 |
gttaaagatgtagaaagaattaacaaaaatcatttgtgtgctaagtaaaatatattgtgtgcaacctattgagaaacaaagtgagggagaaggagaacaa |
115 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48520867 |
gttaaaaatgtagaaagaattaacaaaaatcatttgtatgctaagtaaaatatattgtgtgcaacctattgagaaacaaagtgagggagaaggagaacaa |
48520768 |
T |
|
| Q |
116 |
ggaggaagaagagggaaccacttggaggagctgttttggaagtcaatggcattggacttggatacataaagtaagaaaataggaaggaagtcatggtggt |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48520767 |
ggaggaagaagagggaaccacttggaggagctgttttggaaggcaatggcattggacttggatacataaagtaagaaaataggaaggaagtcatggtggt |
48520668 |
T |
|
| Q |
216 |
taaccccccaacactgttacaact |
239 |
Q |
| |
|
| |||||||||||||||||||||| |
|
|
| T |
48520667 |
t-accccccaacactgttacaact |
48520645 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University