View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14404_high_60 (Length: 249)
Name: NF14404_high_60
Description: NF14404
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14404_high_60 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 205; Significance: 1e-112; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 205; E-Value: 1e-112
Query Start/End: Original strand, 1 - 242
Target Start/End: Complemental strand, 35753667 - 35753420
Alignment:
| Q |
1 |
caagggcggccacaattaaggcggatttctcagaaactatttatggcatgtcttgattatcagtaattgtctttttattacaagttgatatttgatttcc |
100 |
Q |
| |
|
|||| |||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
35753667 |
caagagcggccacaattaaggcggatttctcggaaactatttatggcatgtcttgattatcagtaattgtctttttattacaagttgatacttgatttcc |
35753568 |
T |
|
| Q |
101 |
tttcgtgataggttgtagac------cctgcttttgagttttagcgagactgtgtcggggagatcaagcttgtttgcattgcattaagaaaaagtgtgtg |
194 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35753567 |
tttcgtgataggttgtagacgtagaccctgcttttgagttttagtgagactgtgtcggggagatcaagcttgtttgcattgcattaagaaaaagtgtgtg |
35753468 |
T |
|
| Q |
195 |
tggcttgtaatctatctaattcctgaaatatgagcgtggttctgtgct |
242 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
35753467 |
tggcttgtaatctatctaattcctgaaatatgagcgtggttttgtgct |
35753420 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University