View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14404_high_62 (Length: 247)
Name: NF14404_high_62
Description: NF14404
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14404_high_62 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 133; Significance: 3e-69; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 133; E-Value: 3e-69
Query Start/End: Original strand, 61 - 242
Target Start/End: Complemental strand, 7652006 - 7651837
Alignment:
| Q |
61 |
ctctttaggcaaattgaacttaacacctttcatatttggattttgatttggtggtggcatcatcatgttcatgtccttgaattgaggccccttaagatct |
160 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
7652006 |
ctctttaggcaaattgaccttaacacctttcatatttggattttgatttggtggtggcatcatcatgttcatgtccttgaattgagtccccttaagatct |
7651907 |
T |
|
| Q |
161 |
tcaagtcctttcatctgctgaagttgttgcaactgttgttgaagctgttgttgaggattctgctcttgttgtccacctccct |
242 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7651906 |
tcaagtcctttcatctgctgaagtt------------gttgaagctgttgttgaggattctgctcttgttgtccacctccct |
7651837 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 91; E-Value: 3e-44
Query Start/End: Original strand, 61 - 199
Target Start/End: Complemental strand, 7657407 - 7657269
Alignment:
| Q |
61 |
ctctttaggcaaattgaacttaacacctttcatatttggattttgatttggtggtggcatcatcatgttcatgtccttgaattgaggccccttaagatct |
160 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||| ||||||||||||||||||||| |||||||||||||||||||||||||| |||| |||||| |
|
|
| T |
7657407 |
ctcttcaggcaaattgaacttaacacctttcatatttgtattttgatttggtggtggcattttcatgttcatgtccttgaattgaggcaccttcagatct |
7657308 |
T |
|
| Q |
161 |
tcaagtcctttcatctgctgaagttgttgcaactgttgt |
199 |
Q |
| |
|
||| |||||| || || ||||||||||||| ||||||| |
|
|
| T |
7657307 |
ccaaatcctttaatatgttgaagttgttgcagctgttgt |
7657269 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 33; Significance: 0.000000001; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 167 - 207
Target Start/End: Original strand, 48539049 - 48539089
Alignment:
| Q |
167 |
cctttcatctgctgaagttgttgcaactgttgttgaagctg |
207 |
Q |
| |
|
||||||||||| ||||||||||| ||||||||||||||||| |
|
|
| T |
48539049 |
cctttcatctgttgaagttgttgtaactgttgttgaagctg |
48539089 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 167 - 207
Target Start/End: Original strand, 48573304 - 48573344
Alignment:
| Q |
167 |
cctttcatctgctgaagttgttgcaactgttgttgaagctg |
207 |
Q |
| |
|
||||||||||| ||||||||||| ||||||||||||||||| |
|
|
| T |
48573304 |
cctttcatctgttgaagttgttgtaactgttgttgaagctg |
48573344 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University