View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14404_high_68 (Length: 237)
Name: NF14404_high_68
Description: NF14404
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14404_high_68 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 110; Significance: 1e-55; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 110; E-Value: 1e-55
Query Start/End: Original strand, 1 - 125
Target Start/End: Original strand, 5213593 - 5213715
Alignment:
| Q |
1 |
tgacatcacaagagaatgtattcccattagttgacttgagaagagagagtggtttgcagcgggaatgaattttctctagtgagattttcactagattttc |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5213593 |
tgacatcacaagagaatgtattcccattagttgacttgagaagag--agtggtttgcagcgggaatgaattttctctagtgagattttcactagattttc |
5213690 |
T |
 |
| Q |
101 |
tccaatttaaaccccaccattgaaa |
125 |
Q |
| |
|
||||||||||| ||||||||||||| |
|
|
| T |
5213691 |
tccaatttaaatcccaccattgaaa |
5213715 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 91; E-Value: 3e-44
Query Start/End: Original strand, 123 - 221
Target Start/End: Original strand, 5213745 - 5213843
Alignment:
| Q |
123 |
aaatcatctctatcccttgaaccacctcatatcagatttttgttatcaggtcacccatcatttatatctacatatcaagtacaataatgttggacgtaa |
221 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
5213745 |
aaattatctctatcccttgaaccacctcatatcagatttttgttatcaggtcacccatcatttatatctacgtatcaagtacaataatgttggacgtaa |
5213843 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University