View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14404_high_73 (Length: 229)
Name: NF14404_high_73
Description: NF14404
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14404_high_73 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 106; Significance: 3e-53; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 106; E-Value: 3e-53
Query Start/End: Original strand, 64 - 213
Target Start/End: Complemental strand, 3789338 - 3789189
Alignment:
| Q |
64 |
ctaatgattaaaagtgattggcaatgtaatannnnnnnnacaccaacaacgcatactactagtagtaatatcctcaaaacaattatctgttatgacatgt |
163 |
Q |
| |
|
||||||||||||||||||||| ||||||||| |||||||||||||||| |||||||||||||||||| |||||||||||| |||||||||||| |
|
|
| T |
3789338 |
ctaatgattaaaagtgattggtaatgtaatattttttttacaccaacaacgcatagtactagtagtaatatcctaaaaacaattatccgttatgacatgt |
3789239 |
T |
 |
| Q |
164 |
gtcacctccaaattatttggttattttactagataactttgtcattaatt |
213 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
3789238 |
gtcacctccaaattatttgattattttactagataactttgtcattaatt |
3789189 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 34 - 71
Target Start/End: Complemental strand, 3794057 - 3794020
Alignment:
| Q |
34 |
ttatgattaaaatcaaatatttttattcatctaatgat |
71 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
3794057 |
ttatgattaaaatcaaatatttttattgatctaatgat |
3794020 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University