View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14404_high_77 (Length: 217)
Name: NF14404_high_77
Description: NF14404
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14404_high_77 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 123; Significance: 2e-63; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 123; E-Value: 2e-63
Query Start/End: Original strand, 19 - 149
Target Start/End: Complemental strand, 4015716 - 4015586
Alignment:
| Q |
19 |
cacgaaacccttcgctcttaacaataatcacgaagaacacaatctgtattccgggatatcacgttgaacataaggaagaattcagcatcgttagacaccc |
118 |
Q |
| |
|
|||||||| |||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4015716 |
cacgaaactcttcgctcttaaaaataatcacgaagaacacaatctgtattccgggatatcacgttgaacataaggaagaattcagcatcgttagacaccc |
4015617 |
T |
|
| Q |
119 |
tatacatcgtgtattccaaaaccattccttc |
149 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
4015616 |
tatacatcgtgtattccaaaaccattccttc |
4015586 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 155 - 202
Target Start/End: Complemental strand, 4015520 - 4015473
Alignment:
| Q |
155 |
gatagttgattcctgtaatggattgcttcttttggaagttgtttctga |
202 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4015520 |
gatagttgattcctgtaatggattgcttcttttggaagttgtttctga |
4015473 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University