View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14404_low_30 (Length: 360)
Name: NF14404_low_30
Description: NF14404
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14404_low_30 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 288; Significance: 1e-161; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 288; E-Value: 1e-161
Query Start/End: Original strand, 1 - 347
Target Start/End: Original strand, 30633328 - 30633673
Alignment:
| Q |
1 |
tcccgaaaattattatctttcaaaatagtttctgaaattgaannnnnnnnnnagtcctcgaaattctcttgtacagattaatgttgtagagacttttaaa |
100 |
Q |
| |
|
|||||||||||| ||| ||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30633328 |
tcccgaaaattactatatttcaaaatagtttctgaaattgaattttttttt-agtcctcgaaattctcttgtacagattaatgttgtagagacttttaaa |
30633426 |
T |
 |
| Q |
101 |
cttcactggtcattttgaaatttcgtcagtttaattggtcaaattatcagtgtcctatagtctcagtgattaagttggtgattcgacggcgtataagtgt |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |||||||||| |
|
|
| T |
30633427 |
attcactggtcattttgaaatttcgtcagtttaattggtcaaattatcagtgtcctatagtctcatggattaagttggtgattcgacggtgtataagtgt |
30633526 |
T |
 |
| Q |
201 |
tttagaatttgaatcttatggtatacggtgtagtaattttcgtggatgttatggtttagcagatggtaaaagcaaggatttgctaacaatgaagcagaat |
300 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30633527 |
tttagaatttgaatcttatggtatacggtgtagtaattttcgtggatgttatggtttagcagatggtaaaagcaaggatttgctaacaatgaagcagaat |
30633626 |
T |
 |
| Q |
301 |
gaggatgaatgggtggagtaccggaatgtgatggatggtgttattga |
347 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30633627 |
gaggatgaatgggtggagtaccggaatgtgatggatggtgttattga |
30633673 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University