View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14404_low_39 (Length: 306)
Name: NF14404_low_39
Description: NF14404
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14404_low_39 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 226; Significance: 1e-124; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 226; E-Value: 1e-124
Query Start/End: Original strand, 18 - 296
Target Start/End: Original strand, 27303488 - 27303761
Alignment:
| Q |
18 |
gtttagagtgtcatatgcatcaaatatggatttttgttatttccttccaatccatgtgttttgcttcccaatagtacatgaggtgctggttgaatcaaat |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
27303488 |
gtttagagtgtcatatgcatcaaatatggatttttgttatttccttccaatccatgt-ttttgcttcc-aatagtacatgaggtgctggttgaatcaaat |
27303585 |
T |
 |
| Q |
118 |
gtcaactgcagccacgtattttacataaatgccactactt--tgatagtcactcttcattcaattcaattcaattctattaacagtgtttacctgtgact |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
27303586 |
gtcaactgcagccacgtattttacataaatgccactacttgttgatagtcactcttcattc-----aattcaattctattaacagtgtttacctgtgact |
27303680 |
T |
 |
| Q |
216 |
tccttcaccttttccataggtccctttcccacatatatctatctttgcttacaagttccaacaatcatcaccttcttcatc |
296 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| ||||| |||||||||||||||||||||||||||||| |
|
|
| T |
27303681 |
tccttcaccttttccataggtccctttcccacatatatctatctctgcttccaagttccaacaatcatcaccttcttcatc |
27303761 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University