View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14404_low_41 (Length: 292)
Name: NF14404_low_41
Description: NF14404
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14404_low_41 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 234; Significance: 1e-129; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 234; E-Value: 1e-129
Query Start/End: Original strand, 17 - 277
Target Start/End: Original strand, 3934915 - 3935178
Alignment:
| Q |
17 |
aacaacatagtggcatcaccaattgccaaattcatcaaacacacctacaaagaaaaacagagacaaaccataatgaatgcttttgatatttcagctagaa |
116 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3934915 |
aacaacatagtggcatcaccaactgccaaattcatcaaacacacctacaaagaaaaacagagacaaaccataatgaatgcttttgatatttcagctagaa |
3935014 |
T |
 |
| Q |
117 |
gc---tgccacaacatggcattggccacgacgccgtttcgccacctttcttcgtcttatcatttaatgacgttgaagttacaacaccatgtcagcattgg |
213 |
Q |
| |
|
|| ||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3935015 |
gcagctgccacaacattgcattggccacgacgccgtttcgccacctttcttcgtcttatcatttaatgacgttgaagttacaacaccatgtcagcattgg |
3935114 |
T |
 |
| Q |
214 |
agatagacggagcattcgagtggttagaattacggcatcattgaggccaaataccgactcaact |
277 |
Q |
| |
|
||| ||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
3935115 |
agagagacggagcattcgagtggttagaattacggcatcattgtggccaaataccgactcaact |
3935178 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University