View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14404_low_48 (Length: 276)
Name: NF14404_low_48
Description: NF14404
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14404_low_48 |
 |  |
|
| [»] chr6 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 90; Significance: 1e-43; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 90; E-Value: 1e-43
Query Start/End: Original strand, 162 - 276
Target Start/End: Complemental strand, 3935350 - 3935236
Alignment:
| Q |
162 |
accttctacatgaattcaacgtgatcacaaatannnnnnnggatagaaaaataaaagagagacaaattatagtaccagcgtgaacggtttttgatccatc |
261 |
Q |
| |
|
|||||| |||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3935350 |
accttccacatgaattcaacgtgatcacaaatatttttttggatagaaaaataaaagagagacaaattatagtaccagcgtgaacggtttttgatccatc |
3935251 |
T |
 |
| Q |
262 |
acatttcaaaaacga |
276 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
3935250 |
acatttcaaaaacga |
3935236 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University