View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF14404_low_52 (Length: 267)

Name: NF14404_low_52
Description: NF14404
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF14404_low_52
NF14404_low_52
[»] chr3 (1 HSPs)
chr3 (1-261)||(23337003-23337264)


Alignment Details
Target: chr3 (Bit Score: 194; Significance: 1e-105; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 194; E-Value: 1e-105
Query Start/End: Original strand, 1 - 261
Target Start/End: Original strand, 23337003 - 23337264
Alignment:
1 aagtatctatgcttgttgacataccttcatagttttagtnnnnnnnctaagaagaagcttttgtgttccactgattgtttttgctagttgttttgtctgg 100  Q
    |||||||||| ||||||||||||||||||||||||||||       ||||||||||||||||||||||||||||||||||||||||||||||||||||||    
23337003 aagtatctatacttgttgacataccttcatagttttagtaaaaaaactaagaagaagcttttgtgttccactgattgtttttgctagttgttttgtctgg 23337102  T
101 attctattgggctcttgtttatatccggtttatcattattttc-nnnnnnnnnaatcttatgtatataaaaattataaaatatgataaagtttcactttc 199  Q
    ||||||||||||||||||||||||||||||||||||| |||||          ||||||||||||||||||||||||||||||||||||||||| |||||    
23337103 attctattgggctcttgtttatatccggtttatcatttttttcttttctttttaatcttatgtatataaaaattataaaatatgataaagtttctctttc 23337202  T
200 tttacttatactttcagacaaacaatatagtaataaaatatttcaacttcatagcataatta 261  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
23337203 tttacttatactttcagacaaacaatatagtaataaaatatttcaacttcatagcataatta 23337264  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University