View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14404_low_52 (Length: 267)
Name: NF14404_low_52
Description: NF14404
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14404_low_52 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 194; Significance: 1e-105; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 194; E-Value: 1e-105
Query Start/End: Original strand, 1 - 261
Target Start/End: Original strand, 23337003 - 23337264
Alignment:
| Q |
1 |
aagtatctatgcttgttgacataccttcatagttttagtnnnnnnnctaagaagaagcttttgtgttccactgattgtttttgctagttgttttgtctgg |
100 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23337003 |
aagtatctatacttgttgacataccttcatagttttagtaaaaaaactaagaagaagcttttgtgttccactgattgtttttgctagttgttttgtctgg |
23337102 |
T |
 |
| Q |
101 |
attctattgggctcttgtttatatccggtttatcattattttc-nnnnnnnnnaatcttatgtatataaaaattataaaatatgataaagtttcactttc |
199 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| ||||| ||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
23337103 |
attctattgggctcttgtttatatccggtttatcatttttttcttttctttttaatcttatgtatataaaaattataaaatatgataaagtttctctttc |
23337202 |
T |
 |
| Q |
200 |
tttacttatactttcagacaaacaatatagtaataaaatatttcaacttcatagcataatta |
261 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23337203 |
tttacttatactttcagacaaacaatatagtaataaaatatttcaacttcatagcataatta |
23337264 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University