View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14404_low_59 (Length: 254)
Name: NF14404_low_59
Description: NF14404
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14404_low_59 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 174; Significance: 1e-93; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 174; E-Value: 1e-93
Query Start/End: Original strand, 34 - 238
Target Start/End: Complemental strand, 36721952 - 36721747
Alignment:
| Q |
34 |
atagatttgataggcacgagagtctcagtgtgatgcccaaatagtgctaacaaacaaccaaatcaaaaaatatt-acagatgagaacaacaaagatgaaa |
132 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || ||| ||||||||||||||||||||| |
|
|
| T |
36721952 |
atagatttgataggcacgagagtctcagtgtgatgcccaaatagtgctaacaaacaaccaaatcaaaaaatctttacaaatgagaacaacaaagatgaaa |
36721853 |
T |
 |
| Q |
133 |
aatacccaaataaattacttttcacatcaacaaaacactctcctaatatcatgactcatgagagataaggactagaaaatttgagtctttctccacattg |
232 |
Q |
| |
|
||||||||||||||||| ||||| || |||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
36721852 |
aatacccaaataaattatttttcccaccaacaaaacactctcctaatatcatgactcatgagagataagaactagaaaatttgagtctttctccacattg |
36721753 |
T |
 |
| Q |
233 |
gaaggg |
238 |
Q |
| |
|
|||||| |
|
|
| T |
36721752 |
gaaggg |
36721747 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University