View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14404_low_72 (Length: 236)
Name: NF14404_low_72
Description: NF14404
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14404_low_72 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 165; Significance: 2e-88; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 165; E-Value: 2e-88
Query Start/End: Original strand, 1 - 221
Target Start/End: Original strand, 35753687 - 35753920
Alignment:
| Q |
1 |
attgtctgctttcatttccgtaataaagca---ggtcgccgagttggtttagtcccacgtcgcctagagatattgcttacgtagtacttataaagcatag |
97 |
Q |
| |
|
|||||||||||||||| ||||||||||||| |||| ||| |||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35753687 |
attgtctgctttcattgccgtaataaagcacagggtcaccgcgttggtttagtcccacatcgcctagagatattgcttacgtagtacttataaagcatag |
35753786 |
T |
 |
| Q |
98 |
acagttctaagataaatagtcaagtgactgaatcccgacaaatgcactaaaagaaaccgaa----------atgtcaaacattcaaacagcacaaaatca |
187 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
35753787 |
acagttctaagataaatagtcaagtgactgaatcccgacaaatgcacaaaaagaaaccgaatcaacgaagtatgtcaaacattcaaacagcacaaaatca |
35753886 |
T |
 |
| Q |
188 |
tgctcttttttcaggaatttgatagtttacaagc |
221 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
35753887 |
tgctcttttttcaggaatttgatagtttacaagc |
35753920 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 159 - 221
Target Start/End: Original strand, 35753403 - 35753465
Alignment:
| Q |
159 |
atgtcaaacattcaaacagcacaaaatcatgctcttttttcaggaatttgatagtttacaagc |
221 |
Q |
| |
|
||||||||||||||| |||||||||| || |||| | ||||||||||| ||||| |||||||| |
|
|
| T |
35753403 |
atgtcaaacattcaagcagcacaaaaccacgctcatatttcaggaattagatagattacaagc |
35753465 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University