View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF14404_low_75 (Length: 233)

Name: NF14404_low_75
Description: NF14404
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF14404_low_75
NF14404_low_75
[»] chr5 (1 HSPs)
chr5 (1-122)||(4284127-4284248)
[»] chr4 (2 HSPs)
chr4 (81-122)||(8682280-8682321)
chr4 (83-122)||(6348737-6348776)


Alignment Details
Target: chr5 (Bit Score: 114; Significance: 6e-58; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 114; E-Value: 6e-58
Query Start/End: Original strand, 1 - 122
Target Start/End: Original strand, 4284127 - 4284248
Alignment:
1 caaacgtggccggaggaatagagagagtgacggtggttaacagggagatcggcagtgatttccgtcgggatttggtgaagttgggggtttagggttttga 100  Q
    ||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |||||||||||||||||||||||||||||||||||||    
4284127 caaacgtggccggaggaatagagagagtgacggtggttaacggggagatcggcagtgatttctgtcgggatttggtgaagttgggggtttagggttttga 4284226  T
101 gatggaaattgattttggattt 122  Q
    ||||||||||||||||||||||    
4284227 gatggaaattgattttggattt 4284248  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4 (Bit Score: 38; Significance: 0.000000000001; HSPs: 2)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 81 - 122
Target Start/End: Original strand, 8682280 - 8682321
Alignment:
81 ttgggggtttagggttttgagatggaaattgattttggattt 122  Q
    |||| |||||||||||||||||||||||||||||||||||||    
8682280 ttggtggtttagggttttgagatggaaattgattttggattt 8682321  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 83 - 122
Target Start/End: Complemental strand, 6348776 - 6348737
Alignment:
83 gggggtttagggttttgagatggaaattgattttggattt 122  Q
    |||||||||||||||||||||| |||||||||||| ||||    
6348776 gggggtttagggttttgagatgcaaattgattttgtattt 6348737  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University