View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14404_low_75 (Length: 233)
Name: NF14404_low_75
Description: NF14404
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14404_low_75 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 114; Significance: 6e-58; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 114; E-Value: 6e-58
Query Start/End: Original strand, 1 - 122
Target Start/End: Original strand, 4284127 - 4284248
Alignment:
| Q |
1 |
caaacgtggccggaggaatagagagagtgacggtggttaacagggagatcggcagtgatttccgtcgggatttggtgaagttgggggtttagggttttga |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4284127 |
caaacgtggccggaggaatagagagagtgacggtggttaacggggagatcggcagtgatttctgtcgggatttggtgaagttgggggtttagggttttga |
4284226 |
T |
 |
| Q |
101 |
gatggaaattgattttggattt |
122 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
4284227 |
gatggaaattgattttggattt |
4284248 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 38; Significance: 0.000000000001; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 81 - 122
Target Start/End: Original strand, 8682280 - 8682321
Alignment:
| Q |
81 |
ttgggggtttagggttttgagatggaaattgattttggattt |
122 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8682280 |
ttggtggtttagggttttgagatggaaattgattttggattt |
8682321 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 83 - 122
Target Start/End: Complemental strand, 6348776 - 6348737
Alignment:
| Q |
83 |
gggggtttagggttttgagatggaaattgattttggattt |
122 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||| |||| |
|
|
| T |
6348776 |
gggggtttagggttttgagatgcaaattgattttgtattt |
6348737 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University