View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF14404_low_81 (Length: 217)

Name: NF14404_low_81
Description: NF14404
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF14404_low_81
NF14404_low_81
[»] chr1 (2 HSPs)
chr1 (19-149)||(4015586-4015716)
chr1 (155-202)||(4015473-4015520)


Alignment Details
Target: chr1 (Bit Score: 123; Significance: 2e-63; HSPs: 2)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 123; E-Value: 2e-63
Query Start/End: Original strand, 19 - 149
Target Start/End: Complemental strand, 4015716 - 4015586
Alignment:
19 cacgaaacccttcgctcttaacaataatcacgaagaacacaatctgtattccgggatatcacgttgaacataaggaagaattcagcatcgttagacaccc 118  Q
    |||||||| |||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
4015716 cacgaaactcttcgctcttaaaaataatcacgaagaacacaatctgtattccgggatatcacgttgaacataaggaagaattcagcatcgttagacaccc 4015617  T
119 tatacatcgtgtattccaaaaccattccttc 149  Q
    |||||||||||||||||||||||||||||||    
4015616 tatacatcgtgtattccaaaaccattccttc 4015586  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 155 - 202
Target Start/End: Complemental strand, 4015520 - 4015473
Alignment:
155 gatagttgattcctgtaatggattgcttcttttggaagttgtttctga 202  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||    
4015520 gatagttgattcctgtaatggattgcttcttttggaagttgtttctga 4015473  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University