View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14404_low_82 (Length: 215)
Name: NF14404_low_82
Description: NF14404
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14404_low_82 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 92; Significance: 7e-45; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 92; E-Value: 7e-45
Query Start/End: Original strand, 71 - 196
Target Start/End: Complemental strand, 48823552 - 48823428
Alignment:
| Q |
71 |
gttagggaaagaacaactgaaatattatcacgccatatcggcttacataaaaataattttgaaatacagctgtttttcttttgacnnnnnnntacagttg |
170 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| ||| ||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
48823552 |
gttagggaaagaacaactgaaatattatcacgccatatcagctaacataaaaataattttgaaatacagctgtttttcttttgac-aaaaaatacagttg |
48823454 |
T |
 |
| Q |
171 |
ttctgatgcaaaaagcaatactgttc |
196 |
Q |
| |
|
|||||||||||||||||||||||||| |
|
|
| T |
48823453 |
ttctgatgcaaaaagcaatactgttc |
48823428 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University