View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14405_high_3 (Length: 328)
Name: NF14405_high_3
Description: NF14405
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14405_high_3 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 129; Significance: 9e-67; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 129; E-Value: 9e-67
Query Start/End: Original strand, 142 - 318
Target Start/End: Complemental strand, 6735568 - 6735392
Alignment:
| Q |
142 |
gaagcagaatgaacagtgttgtaccattaatcaaacattaacttaaggggtgcaaattttaaattttagacagcaaagacaaatcaaacttcaaattcaa |
241 |
Q |
| |
|
|||||||||||| |||| |||| |||||||| ||||||||||||||| ||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
6735568 |
gaagcagaatgatcagtcttgtttcattaatcgaacattaacttaaggagtgcaaattttaaattttagacagcaaagccaaatcaaacttcaaattcaa |
6735469 |
T |
 |
| Q |
242 |
atatgtaaaccaatcacagtactctctactcagtgaggtagatactgaaatgcaagatggtgtcagccccatctgtg |
318 |
Q |
| |
|
|||| ||||||||||||||| | |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6735468 |
gtatgaaaaccaatcacagtagccactactcagtgaggtagatactgaaatgcaagatggtgtcagccccatctgtg |
6735392 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 84; E-Value: 7e-40
Query Start/End: Original strand, 1 - 84
Target Start/End: Complemental strand, 6735712 - 6735629
Alignment:
| Q |
1 |
ttagataacaatatatgaggaatgttgattgtgcaatattgtattacaacagaatgttcttacagcatgtagcagcaatgaggg |
84 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6735712 |
ttagataacaatatatgaggaatgttgattgtgcaatattgtattacaacagaatgttcttacagcatgtagcagcaatgaggg |
6735629 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University