View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14405_low_17 (Length: 212)
Name: NF14405_low_17
Description: NF14405
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14405_low_17 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 186; Significance: 1e-101; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 186; E-Value: 1e-101
Query Start/End: Original strand, 1 - 198
Target Start/End: Complemental strand, 33453661 - 33453464
Alignment:
| Q |
1 |
aagctttaccatctttttctatgatgtcccacttgaagagaaaaagatacatttatgagaataatcaatgaacaatgacaaatttgattttttgtgtgtg |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| | |
|
|
| T |
33453661 |
aagctttaccatctttttctatgatgtcccacttgaagagaaaaagatacatttatgagaataatcaatgaacaatgactaatttgattttttgtgtgcg |
33453562 |
T |
|
| Q |
101 |
atattaaattttttaggaaaagaatcatggtagctacgatttcatttttgtggatgctgacaaagacaattacctcaactaccataagaggttaattg |
198 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33453561 |
atattaatttttttaggaaaagaatcatggtagctacgatttcatttttgtggatgctgacaaagacaattacctcaactaccataagaggttaattg |
33453464 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University