View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14406_high_20 (Length: 308)
Name: NF14406_high_20
Description: NF14406
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14406_high_20 |
 |  |
|
| [»] scaffold0064 (2 HSPs) |
 |  |  |
|
| [»] scaffold0116 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold0064 (Bit Score: 257; Significance: 1e-143; HSPs: 2)
Name: scaffold0064
Description:
Target: scaffold0064; HSP #1
Raw Score: 257; E-Value: 1e-143
Query Start/End: Original strand, 14 - 286
Target Start/End: Original strand, 21669 - 21941
Alignment:
| Q |
14 |
aggctagcaatcagttcccaaattaaggcgaggatgggctcgttgaaagctatggaaggaaggatgagattctcactgtcatgattttcatcggagcggg |
113 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21669 |
aggctagcaatcagttcccaaattgaggcgaggatgggctcgttgaaagctatggaaggaaggatgagattctcactgtcatgattttcatcggagcggg |
21768 |
T |
 |
| Q |
114 |
agatatgtagaagccaggaaacgtcgttgatggagttttcaagttgggaggatgttttgcgtaaagcatcaattgagatgatggtgaagatgcgcttctt |
213 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||||||||||||| ||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21769 |
agatatgtagaagccaggaaacatcgttgatggagttttcaagttgggaagatgttttgcggaaagcatcaattgagatgatggtgaagatgcgcttctt |
21868 |
T |
 |
| Q |
214 |
gatgttgtttgggcggcacttgaggatcaatgaaagggtttcattgagtatatgttcggtttgctcgaggatc |
286 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21869 |
gatgttgtttgggcggcacttgaggatcaatgaaagggtttcattgagtatatgttcggtttgctcgaggatc |
21941 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0064; HSP #2
Raw Score: 62; E-Value: 8e-27
Query Start/End: Original strand, 10 - 291
Target Start/End: Original strand, 4454 - 4735
Alignment:
| Q |
10 |
acataggctagcaatcagttcccaaattaaggcgaggatgggctcgttgaaagctatggaaggaaggatgagattctcactgtcatgattttcatcggag |
109 |
Q |
| |
|
||||||||| ||||| |||||||||||||||| | ||||| || || ||| |||||||||||||||| |||| ||||| ||||||| ||||| | || |
|
|
| T |
4454 |
acataggctggcaataagttcccaaattaaggtaaccatggggtcatttaaaattatggaaggaaggatgtgattttcactatcatgatcttcattgcag |
4553 |
T |
 |
| Q |
110 |
cgggagatatgtagaagccaggaaacgtcgttgatggagttttcaagttgggaggatgttttgcgtaaagcatcaattgagatgatggtgaagatgcgct |
209 |
Q |
| |
|
|||||||||| || ||||| ||||| | | |||| |||||||||||||||||||||| | | |||| | | | ||||||| |||||| |||| |
|
|
| T |
4554 |
cgggagatatataatagccaagaaacattgcctatggtgttttcaagttgggaggatgttcggtggaaagtggctttggggatgatgttgaagacacgct |
4653 |
T |
 |
| Q |
210 |
tcttgatgttgtttgggcggcacttgaggatcaatgaaagggtttcattgagtatatgttcggtttgctcgaggatcggctg |
291 |
Q |
| |
|
|| ||||| ||| || ||||| ||||||| ||| |||||||| | |||||||| ||||||||||| || ||||||| |||| |
|
|
| T |
4654 |
tcctgatggtgtctgtacggcatttgaggaccaacgaaagggtcttattgagtacatgttcggttttcttgaggatctgctg |
4735 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0116 (Bit Score: 168; Significance: 5e-90; HSPs: 1)
Name: scaffold0116
Description:
Target: scaffold0116; HSP #1
Raw Score: 168; E-Value: 5e-90
Query Start/End: Original strand, 14 - 289
Target Start/End: Original strand, 10658 - 10933
Alignment:
| Q |
14 |
aggctagcaatcagttcccaaattaaggcgaggatgggctcgttgaaagctatggaaggaaggatgagattctcactgtcatgattttcatcggagcggg |
113 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||||| ||||||||||||||||||||||| | ||| ||| ||||| | |||||||||||||||| |
|
|
| T |
10658 |
aggctagcaatcagctcccaaattaaggcgaggatgggctcattgaaagctatggaaggaaggataaaattttcattgtcaagcttttcatcggagcggg |
10757 |
T |
 |
| Q |
114 |
agatatgtagaagccaggaaacgtcgttgatggagttttcaagttgggaggatgttttgcgtaaagcatcaattgagatgatggtgaagatgcgcttctt |
213 |
Q |
| |
|
|||||||||| |||||| ||||| ||| ||||||||||||||||||| |||||||||||| ||||||||||| ||||||||||| ||||| |||||| |
|
|
| T |
10758 |
agatatgtaggagccagtgaacgttgtttatggagttttcaagttgggtggatgttttgcggaaagcatcaatggagatgatggtaaagatcaacttctt |
10857 |
T |
 |
| Q |
214 |
gatgttgtttgggcggcacttgaggatcaatgaaagggtttcattgagtatatgttcggtttgctcgaggatcggc |
289 |
Q |
| |
|
||||| |||||| || |||| |||||||| |||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
10858 |
gatgtgatttgggtggaacttaaggatcaacgaaagggtctcattgagtatatgttcggtttgctcgaggatcggc |
10933 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University