View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14406_high_26 (Length: 239)
Name: NF14406_high_26
Description: NF14406
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14406_high_26 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 201; Significance: 1e-110; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 201; E-Value: 1e-110
Query Start/End: Original strand, 19 - 227
Target Start/End: Complemental strand, 4266634 - 4266426
Alignment:
| Q |
19 |
aatgcatgggttgggagactcaactatttgagttaagggttaagaagtttgaggttcatggttaagttatgacaaaaactaacatattatcgtttattat |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4266634 |
aatgcatgggttgggagactcaactatttgagttaagggttaagaagtttgaggttcatggttaagttatgacaaaaactaacatattatcgtttattat |
4266535 |
T |
|
| Q |
119 |
taaaaagaaagaaagagcaatgcatgtttgtgcttgcggtgtagagcgtacattgcttgcaccttcatattagtccaatctaccaataattttacatgag |
218 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
4266534 |
taaaaagaaagaaagagcaatgcatgtttgtgcctgcggtgtagagcgtacattgcttgcaccttcatattagtccaatctaccaataatcttacatgag |
4266435 |
T |
|
| Q |
219 |
tataatcta |
227 |
Q |
| |
|
||||||||| |
|
|
| T |
4266434 |
tataatcta |
4266426 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University