View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14406_low_24 (Length: 263)
Name: NF14406_low_24
Description: NF14406
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14406_low_24 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 244; Significance: 1e-135; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 244; E-Value: 1e-135
Query Start/End: Original strand, 1 - 260
Target Start/End: Original strand, 37337616 - 37337875
Alignment:
| Q |
1 |
ctttttctacttaaaacttcctttttaagcttcttaacaagtgcccttatagaatttgttagcacgaccctttcttattattattacaattgtttcagat |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37337616 |
ctttttctacttaaaacttcctttttaagcttcttaacaagtgcccttacggaatttgttagcacgaccctttcttattattattacaattgtttcagat |
37337715 |
T |
|
| Q |
101 |
aaagatggatgagaatggagaaaatcctagtaatattgcaagtactgattttaactttgccttattatcaattagcagtgatgatgatgaagggtgtgat |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
37337716 |
aaagatggatgagaatggagaaaatcctagtaatattgcaagtactgattttaactttgccttattatcaattagtagtgatgatgatgaagggtgtgat |
37337815 |
T |
|
| Q |
201 |
aaacccccagggctagtagccagactcatgggtttggattcattgtctctgtgctcctcc |
260 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
37337816 |
aaacccccagggctagtagccagactcatgggtttggattcattgtctcagtgctcctcc |
37337875 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 29; Significance: 0.0000004; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 88 - 136
Target Start/End: Original strand, 46056406 - 46056454
Alignment:
| Q |
88 |
aattgtttcagataaagatggatgagaatggagaaaatcctagtaatat |
136 |
Q |
| |
|
|||||||| |||||||| ||||||||||||||| || ||| |||||||| |
|
|
| T |
46056406 |
aattgttttagataaaggtggatgagaatggagcaagtccgagtaatat |
46056454 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University