View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14406_low_34 (Length: 219)
Name: NF14406_low_34
Description: NF14406
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14406_low_34 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 168; Significance: 3e-90; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 168; E-Value: 3e-90
Query Start/End: Original strand, 13 - 200
Target Start/End: Original strand, 40025233 - 40025420
Alignment:
| Q |
13 |
gattattctcagtgattgcctttaagatatccgaagaattttgtgatgatgataatggtgaccaaagcatgcatgtggtcaaatgtgataccttaactct |
112 |
Q |
| |
|
||||||||||| ||||||| |||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
40025233 |
gattattctcaatgattgcttttaagatatccaaagaattttgtgatgatgataatggtgaccaaagcatgcatgtggtcaaatgtgataccgtaactct |
40025332 |
T |
 |
| Q |
113 |
tccgtagattatgtgagttctagctatccaggacaccctaacaataataattgtttgatgaaaataagttaatcgttacaggcttgag |
200 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40025333 |
tccgtaggttatgtgagttctagctatccaggacaccctaacaataataattgtttgatgaaaataagttaatcgttacaggcttgag |
40025420 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 67; Significance: 6e-30; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 67; E-Value: 6e-30
Query Start/End: Original strand, 57 - 200
Target Start/End: Complemental strand, 4804600 - 4804454
Alignment:
| Q |
57 |
gatgatgataatggtgaccaaagcatgcatgtggtcaaatgtgataccttaactcttccgtagattatgtgagttctagctatccaggacaccctaac-- |
154 |
Q |
| |
|
||||||||| ||||||||||| ||||||| ||||||||||||||||||||||| ||| || ||||||||||||||||||||| ||||| |||||| |
|
|
| T |
4804600 |
gatgatgatggtggtgaccaaaacatgcatatggtcaaatgtgataccttaact-ttcttaaggttatgtgagttctagctatccgggacatcctaacta |
4804502 |
T |
 |
| Q |
155 |
--aataataattgtttgatgaaaataagttaatcgttacaggcttgag |
200 |
Q |
| |
|
||| || ||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
4804501 |
tgaatgatgcttgtttgatgaaaatgagttaatcgttacaggcttgag |
4804454 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University