View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14406_low_36 (Length: 203)
Name: NF14406_low_36
Description: NF14406
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14406_low_36 |
 |  |
|
| [»] chr1 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 175; Significance: 2e-94; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 175; E-Value: 2e-94
Query Start/End: Original strand, 10 - 203
Target Start/End: Original strand, 6318244 - 6318442
Alignment:
| Q |
10 |
aagaatatgcaggcaacaat-----ctaacaagcttttttgaattcatctgtagttcagaaatggcaacaaactaacacgaagcatagatggaaaaatcc |
104 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6318244 |
aagaatatgcaggcaacaatataatctaacaagcttttttgaattcatctgtagttcagaaatggcaacaaactaacacgaagcatagatggaaaaatcc |
6318343 |
T |
 |
| Q |
105 |
accagatacttgtcatgtacaattgatgcagttatctttgagcctcaagtaaaataccgagcaggcttatcaatcaaacaaaggtgaaggtggattagt |
203 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
6318344 |
accagatacttgtcatgtacaattgatgcagttatctttgagcctcaagtaaaataccgagcaggcttatgaatcaaacaaaggtgaaggtggattagt |
6318442 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University