View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
	Query
	Query hiting target	Query hiting target's complemental strand
	Query's complemental strand hiting target	Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF14407_high_10 (Length: 246)

Name: NF14407_high_10

Description: NF14407

Algorithm: BLASTN 2.2.26 [Sep-21-2011]

Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)

[»] NF14407_high_10

[»] chr4 (1 HSPs)

[»] chr7 (1 HSPs)

Target: chr4 (Bit Score: 118; Significance: 3e-60; HSPs: 1)

Name: chr4

Description:

Target: chr4; HSP #1

Raw Score: 118; E-Value: 3e-60

Query Start/End: Original strand, 1 - 148

Target Start/End: Original strand, 6133399 - 6133548

Alignment:

Q	1	tgtactcgtgcgtgattaattaataccttatgaaacacgcatcatagtaatatataattatatattgctaaccaacaatagcttctccccac-aaaacgc	99	Q
		\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\| \|\|\|\|\|\|\|\|\|\|\|\| \|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\| \|\|\|\|\| \|
T	6133399	tgtactcgtgcgtgattaattaataccttatgaagcacgcatcatagaaatatataattatatattgctaaccaacaatagcttctccccacaaaaacac	6133498	T

Q	100	tagtcttt-gactcttacaaacaccaactcacactcagaatcaacaccat	148	Q
		\|\|\|\|\|\|\|\| \|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|
T	6133499	tagtctttaaactcttacaaacaccaactcacactcagaatcaacaccat	6133548	T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7 (Bit Score: 38; Significance: 0.000000000001; HSPs: 1)

Name: chr7

Description:

Target: chr7; HSP #1

Raw Score: 38; E-Value: 0.000000000001

Query Start/End: Original strand, 41 - 106

Target Start/End: Original strand, 20599735 - 20599799

Alignment:

Q	41	atcatagtaatatataattatatattgctaaccaacaatagcttctccccacaaaacgctagtctt	106	Q
		\|\|\|\|\|\|\|\|\| \|\|\|\|\|\| \|\|\|\|\|\|\|\|\|\|\|\|\| \|\|\|\|\|\|\|\| \|\|\|\|\|\|\|\|\|\|\|\|\| \|\|\|\|\|\|\| \|\|\|\|
T	20599735	atcatagtactatatatttatatattgcta-ccaacaattgcttctccccacataacgctactctt	20599799	T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]