View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF14407_low_10 (Length: 246)

Name: NF14407_low_10
Description: NF14407
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF14407_low_10
NF14407_low_10
[»] chr4 (1 HSPs)
chr4 (1-148)||(6133399-6133548)
[»] chr7 (1 HSPs)
chr7 (41-106)||(20599735-20599799)


Alignment Details
Target: chr4 (Bit Score: 118; Significance: 3e-60; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 118; E-Value: 3e-60
Query Start/End: Original strand, 1 - 148
Target Start/End: Original strand, 6133399 - 6133548
Alignment:
1 tgtactcgtgcgtgattaattaataccttatgaaacacgcatcatagtaatatataattatatattgctaaccaacaatagcttctccccac-aaaacgc 99  Q
    |||||||||||||||||||||||||||||||||| |||||||||||| |||||||||||||||||||||||||||||||||||||||||||| ||||| |    
6133399 tgtactcgtgcgtgattaattaataccttatgaagcacgcatcatagaaatatataattatatattgctaaccaacaatagcttctccccacaaaaacac 6133498  T
100 tagtcttt-gactcttacaaacaccaactcacactcagaatcaacaccat 148  Q
    ||||||||  ||||||||||||||||||||||||||||||||||||||||    
6133499 tagtctttaaactcttacaaacaccaactcacactcagaatcaacaccat 6133548  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7 (Bit Score: 38; Significance: 0.000000000001; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 41 - 106
Target Start/End: Original strand, 20599735 - 20599799
Alignment:
41 atcatagtaatatataattatatattgctaaccaacaatagcttctccccacaaaacgctagtctt 106  Q
    ||||||||| |||||| ||||||||||||| |||||||| ||||||||||||| ||||||| ||||    
20599735 atcatagtactatatatttatatattgcta-ccaacaattgcttctccccacataacgctactctt 20599799  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University