View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14407_low_9 (Length: 258)
Name: NF14407_low_9
Description: NF14407
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14407_low_9 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 204; Significance: 1e-111; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 204; E-Value: 1e-111
Query Start/End: Original strand, 15 - 242
Target Start/End: Original strand, 40556289 - 40556516
Alignment:
| Q |
15 |
cacagacaaaatacaaaactgatcgaggagaataaggaagaaaagtcactggagcttcaacatcgaaaatggaggaaagtgtttttgtttctagaatatt |
114 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40556289 |
cacaaacaaaatacaaaactgatcgaggagaataaggaagaaaagtcactggagcttcaacatcgaaaatggaggaaagtgtttttgtttctagaatatt |
40556388 |
T |
|
| Q |
115 |
gaatgaatatggtggtgatgattatcggatgatggaaaatttattatgtttgcgatctaagttcttagctaatcaattcaaagatgatgtttctcatatt |
214 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| || ||||||||||||||||||||||||||||||||||| ||||||||||| ||||| |
|
|
| T |
40556389 |
gaatgaatatggtggtgatgattatcggatgatggaaaatttactaagtttgcgatctaagttcttagctaatcaattcaaaaatgatgtttcttatatt |
40556488 |
T |
|
| Q |
215 |
cttcggtcaaataaccaggagtactatg |
242 |
Q |
| |
|
|||||||||||||||| ||||||||||| |
|
|
| T |
40556489 |
cttcggtcaaataaccgggagtactatg |
40556516 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University