View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14408_high_7 (Length: 262)
Name: NF14408_high_7
Description: NF14408
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14408_high_7 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 123; Significance: 3e-63; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 123; E-Value: 3e-63
Query Start/End: Original strand, 13 - 242
Target Start/End: Original strand, 2498143 - 2498381
Alignment:
| Q |
13 |
aagaatattgtgacatatgtatgtaactaaaaagatctgatcgaatatgtgtnnnnnnnnnttatcttttttaatcgcttataaaaaactaaatttatat |
112 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2498143 |
aagaatattgtg-catatgtatgtaactaaaaagatctgatcgaatatgtgtaaaaaaaa-ttatcttttttaatcgcttataaaaaactaaatttatat |
2498240 |
T |
 |
| Q |
113 |
annnnnnnnnnaatgttgcttctgatccccaaaatcttattaatactatcttagacccatattgctttct------------gctatgctatggtagata |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
2498241 |
-tattttttttaatgttgcttctgatccccaaaatcttattaatactatcttagacccatattgctttcttttattactcctgctatgctatggtagata |
2498339 |
T |
 |
| Q |
201 |
acttccaaaaacactgctttcagttataaagatgtgttcttg |
242 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2498340 |
acttccaaaaacactgctttcagttataaagatgtgttcttg |
2498381 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University