View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14409_high_29 (Length: 204)
Name: NF14409_high_29
Description: NF14409
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14409_high_29 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 196; Significance: 1e-107; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 196; E-Value: 1e-107
Query Start/End: Original strand, 1 - 200
Target Start/End: Original strand, 21589886 - 21590085
Alignment:
| Q |
1 |
tccgtttattttctctctcgaacttcgcttgctccttctttaaattctccacttcctcctcaatggccgttttctctcgtttttgtttctttttatgctc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
21589886 |
tccgtttattttctctctcgaacttcgcttgctccttctttaaattctccacttcctcctcaatggccgttttctctcgtttctgtttctttttatgctc |
21589985 |
T |
 |
| Q |
101 |
cattagtgatgtatcagactccgtcacggagaaaaacatgggtccgagctcagccatccacttgggctctacggctgtggcacattgcatgtactccttg |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21589986 |
cattagtgatgtatcagactccgtcacggagaaaaacatgggtccgagctcagccatccacttgggctctacggctgtggcacattgcatgtactccttg |
21590085 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 156; Significance: 4e-83; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 156; E-Value: 4e-83
Query Start/End: Original strand, 1 - 200
Target Start/End: Complemental strand, 42100997 - 42100798
Alignment:
| Q |
1 |
tccgtttattttctctctcgaacttcgcttgctccttctttaaattctccacttcctcctcaatggccgttttctctcgtttttgtttctttttatgctc |
100 |
Q |
| |
|
||||||||||||||||||| |||| |||||||||||||||||||||||||| ||||||||| |||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
42100997 |
tccgtttattttctctctccaactccgcttgctccttctttaaattctccatttcctcctccatggccgttttctctcgtttctgtttctttttatgctc |
42100898 |
T |
 |
| Q |
101 |
cattagtgatgtatcagactccgtcacggagaaaaacatgggtccgagctcagccatccacttgggctctacggctgtggcacattgcatgtactccttg |
200 |
Q |
| |
|
|| ||||||||||||||||||| |||| ||||||||||||||||| |||||||||||||||| ||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
42100897 |
cagtagtgatgtatcagactccttcacagagaaaaacatgggtcccagctcagccatccactggggctctaccgctgtggcacattgcatgtactccttg |
42100798 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University