View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14409_low_19 (Length: 265)
Name: NF14409_low_19
Description: NF14409
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14409_low_19 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 182; Significance: 2e-98; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 182; E-Value: 2e-98
Query Start/End: Original strand, 11 - 244
Target Start/End: Original strand, 9283127 - 9283360
Alignment:
| Q |
11 |
tggtcgagtgagtattttatttggcagaggaatgtaagttagcaaatgttcctaagaggatatcaattttgatcagtacgcttcgatcacaattgtttca |
110 |
Q |
| |
|
|||| ||||||| |||||||||| |||||||||||||||||||||||||||||||||| ||||||||||||| || ||||||||||||||||| |||||| |
|
|
| T |
9283127 |
tggtagagtgagcattttatttgacagaggaatgtaagttagcaaatgttcctaagagcatatcaattttgaccaatacgcttcgatcacaatagtttca |
9283226 |
T |
|
| Q |
111 |
atggtgatgcctaattctactgctgaaccagcaagccaacttctcaatgagcctcacactgccggctcaaatgtaatattattggctcttttttgagtca |
210 |
Q |
| |
|
|||||||| |||||||||| || ||||||||||||||||||||||||||||||||| ||||||||||||||| |||||||| |||||||||||||||||| |
|
|
| T |
9283227 |
atggtgatacctaattctattgttgaaccagcaagccaacttctcaatgagcctcaaactgccggctcaaatataatattaatggctcttttttgagtca |
9283326 |
T |
|
| Q |
211 |
tctgaacataacatggatatgtatgtgcctgtga |
244 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
9283327 |
tctgaacataacatggatatgtatgtgcctgtga |
9283360 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University