View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14409_low_22 (Length: 249)
Name: NF14409_low_22
Description: NF14409
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14409_low_22 |
 |  |
|
| [»] chr3 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 224; Significance: 1e-123; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 224; E-Value: 1e-123
Query Start/End: Original strand, 9 - 249
Target Start/End: Original strand, 21589515 - 21589757
Alignment:
| Q |
9 |
gataatactttgatcaatggggtgtacacaatttatgttatactcatattttat--gttatacttgatcaatatttcatgcaggtatgtgttgcagatgc |
106 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||||||||| |||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
21589515 |
gataatactttgatcaatggggtgtacacaatctatgttatactcatattttatatgttatacttgattaatatttcatgcaggtatgtgttgcagatgc |
21589614 |
T |
 |
| Q |
107 |
tgaattgatgtatatttaatttttatgtattatacaaaaattcgtatgaggagcaggaagtagcatgagaaaaatcaacttaagcaacaaatcagctatt |
206 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21589615 |
tgaattgatgtatatttaatttttatgtattatacaaaaattcgtatgaggagcaggaagtagcatgagaaaaatcaacttaagcaacaaatcagctatt |
21589714 |
T |
 |
| Q |
207 |
catactttgaagattaatcgttaacattgtttgcatgagttta |
249 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21589715 |
catactttgaagattaatcgttaacattgtttgcatgagttta |
21589757 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University