View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14409_low_28 (Length: 220)
Name: NF14409_low_28
Description: NF14409
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14409_low_28 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 190; Significance: 1e-103; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 190; E-Value: 1e-103
Query Start/End: Original strand, 12 - 205
Target Start/End: Original strand, 52727017 - 52727210
Alignment:
| Q |
12 |
gattatactcggggaggatgaaagcctcatgttcttcacgagctccacttctaacattgaatgttccatacttgaccaaccttccaacccaagacttctt |
111 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52727017 |
gattatactcggggaggatgaaagcctcatgttcttcacgagctccacttctaacattgaatgttccatacttgaccaaccttccaacccaagacttctt |
52727116 |
T |
 |
| Q |
112 |
ctttgttgggctttgatgaccagcattcatcttgttgcacaagtactccttcactatatgcaatcccctctctaccacttctggtggtggtgaa |
205 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
52727117 |
ctttgttgggctttgatgaccagcattcatcttgttgcacaagtactccttcactatatgcaatcccctctctacgacttctggtggtggtgaa |
52727210 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University