View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14410_low_2 (Length: 215)
Name: NF14410_low_2
Description: NF14410
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14410_low_2 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 145; Significance: 2e-76; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 145; E-Value: 2e-76
Query Start/End: Original strand, 15 - 199
Target Start/End: Original strand, 33564535 - 33564717
Alignment:
| Q |
15 |
aatatttctttgctagtcattatttgacaagccacaagatactcacatttcttataatttcctaannnnnnnnngcatatgttgcatttgtaaatttatc |
114 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |||||||||||||||||||||||||| |
|
|
| T |
33564535 |
aatatttctttgctagtcattatttgacaagccacaagatactcacatttcttataatttcttaattttttt--gcatatgttgcatttgtaaatttatc |
33564632 |
T |
|
| Q |
115 |
tttaatgtcattgttatgtcgtcaacacgctacaaatacctacgaattcatgccgtagaatacttggagatgagatgtcttgtat |
199 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
33564633 |
tttaatgtcattgttatgtcgtcaacacgctacaaatacctacgaattcatgccgtggaatacttggagatgagatgtcttgtat |
33564717 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University